Skip to main content

Table 3 qRT-PCR primers (Mus Musculus)

From: Mild exacerbation of obesity- and age-dependent liver disease progression by senolytic cocktail dasatinib + quercetin

Gene Forward (5′–3′) Reverse (5′–3′)
Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
p16 CGCTCTGGCTTTCGTGAACAT GCCCATCATCATCACCTGGTC
Ppar-γ TCGCTGATGCACTGCCTATG GAGAGGTCCACAGAGCTGATT
Cebpa ACTCCTCCTTTTCCTACCG AGGAAGCAGGAATCCTCC
Pgc-1α TCCCATACACAACCGCAGTC ACCCTTGGGGTCATTTGGTG
Plin2 GACCTTGTGTCCTCCGCTTAT CAACCGCAATTTGTGGCTC
Cidec ATGGACTACGCCATGAAGTCT CGGTGCTAACACGACAGGG
Cd36 GAGCAACTGGTGGATGGTTT GCAGAATCAAGGGAGAGCAC
Timp1 GCAACTCGGACCTGGTCATAA CGGCCCGTGATGAGAAACT
Col1a1 GCTCCTCTTAGGGGCCACT CCACGTCTCACCATTGGGG