Skip to main content

Advertisement

Table 2 Protocols for reverse transcription semi-quantitative PCR

From: Tonicity inversely modulates lipocalin-2 (Lcn2/24p3/NGAL) receptor (SLC22A17) and Lcn2 expression via Wnt/β-catenin signaling in renal inner medullary collecting duct cells: implications for cell fate and bacterial infection

  Gapdh Ctnnb1 (β-catenin) Lcn2 Lcn2-R (Slc22a17/24p3-R) hLCN2-R isoform B
Accession number NM_001289726.1 NM_007614.3 NM_008491.1 NM_021551.4 (NM_016609.4)
Forward primer (5‘→3‘) AGGGCTCATGACCACAGT TTAAACTCCTGCACCCACCAT CCACCACGGACTACAACCAG CAGCCACCTCCTAACCGCTGTG GCCATTCGCCACTGCTAC
Reverse primer (5‘→3‘) TGCAGGGATGATGTTCTG AGGGCAAGGTTTCGAATCAA AGCTCCTTGGTTCTTCCATACA CTCCCACTAGGCTCAAAGGCTGCT GGAGAAGAGCCCAAGGACAGA
Activation 5 min 95oC 5 min 95oC 5 min 95oC 5 min 95oC 5 min 95oC
Cycle number 22 27 30-32 27-28 22
Denaturation 30 sec 94oC 30 sec 94oC 30 sec 94oC 30 sec 94oC 30 sec 94°C
Annealing 30 sec 60oC 30 sec 60oC 30 sec 60oC 30 sec 60oC 30 sec 55°C
Extension 30 sec 72oC 30 sec 72oC 30 sec 72oC 30 sec 72oC 30 sec 72°C
Final Extension 7 min 72oC 7 min 72oC 7 min 72oC 7 min 72oC 10 min 72°C
PCR product (bp) 112 73 100 86 255
  1. bp = base pairs