Skip to main content

Advertisement

Table 2 Primer sets used for pyrosequencing, qMSP, RT-qPCR, ChIP-qPCR and for LOI and CNV studies

From: Impairment of IGF2 gene expression in prostate cancer is triggered by epigenetic dysregulation of IGF2-DMR0 and its interaction with KLF4

Assay Primer identity Primer sequence (5′-3′) PCR-size (bp)
Pyro-sequencing IGF2-DMR0-PS-F TTTTTTGTTGTATTTTGGATTTAGATTTTTT 186
IGF2-DMR0-PS-R CTCCAAACACCCCCACCTTAA
IGF2-DMR0-Seq GTGGGGAGGGGGTTTATTTTT
IGF2-H19-ICR-PS-F GGGGGCTCTTGCATAGCACATGGGTA 242
IGF2-H19-ICR-PS-R ATAAACCCTTATCCTATAAATACCCTCA
IGF2-H19-ICR-PS-Seq GGTATTTTTGGAGGTTTTTTT
qMSP GSTP1-MSP-U-F GATGTTTGGGGTGTAGTGGTTGTT 91
GSTP1-MSP-U-R CCACCCCAATACTAAATCACAACA
GSTP1-MSP-M-F TTCGGGGTGTAGCGGTCGTC 97
GSTP1-MSP-M-R GCCCCAATACTAAATCACGACG
RT-qPCR IGF2-RTPCR-F GGGCAAGTTCTTCCAATATGA 214
IGF2-RTPCR-R TCACTTCCGATTGCTGGC
ßActin-RTPCR-F CGGAGTACTTGCGCTCAGGAGGA 226
ßActin-RTPCR-R CCTTCCTTCCTGGGAATGGAGTC
KLF4-RTPCR-F ACTCGCCTTGCTGATTGTCT 127
KLF4-RTPCR-R AATTGGCCGAGATCCTTCTT
AMACR-RTPCR-F ACGACTTACAGGACAGCAGA 181
AMACR-RTPCR-R CCTTCGTCTTCTCTGCAAAT
ChIP-qPCR IGF2-DMR0-ChIP-F CACCCTGGGGCCAAGGCAGT 100
IGF2-DMR0-ChIP-R CTTGAGGGGTCATGGCACGGAAT
LOI study IGF2-LOI-ApaI-F CACCCCCCTCTTTCTCTTCT 245
IGF2-LOI-ApaI-R TACTGGGTCCCTCTGACTGCT
CNV study ZNF80-GCN-F CTGTGACCTGCAGCTCATCCT 120
ZNF80-GCN-R TAAGTTCTCTGACGTTGACTGATGTG
GPR15-GCN-F GGTCCCTGGTGGCCTTAATT 101
GPR15-GCN-R TTGCTGGTAATGGGCACACA
  1. Abbreviations: qMSP quantitative methylation specific PCR, RT-qPCR reverse transcription of RNA in cDNA followed by quantitative real-time PCR, ChIP-qPCR chromatin immunoprecipitation followed by quantitative real-time PCR, IGF2-DMR0 differential methylated region in promoter P0 of the insulin-like growth factor 2 gene, IGF2/H19-ICR imprinting control region of IGF2 and H19 genes, KLF4 Kruppel-like factor 4, AMACR Alpha-methylacyl-CoA racemase, LOI loss of imprinting, CNV copy number variation, bp-base pairs