Skip to main content

Table 1 List of primer sequences used for genotyping, ChIP-PCR and qRT-PCR

From: Kaiso differentially regulates components of the Notch signaling pathway in intestinal cells

Experiment Target Primer sequence 5′-3′
Genotyping fSV40-Kaiso ATCATCAAAGCCGGGTGGGCA
rSV40-Kaiso TTTTCTACTCTCCATTTCATTCAAGTCCTC
ChIP DLL1KBS F AAGCTCTGCAGCTCTCTTGG
DLL1KBS R GGCGACTTTCGTTTTCCTC
JAG1KBS B F AGCTCTTGTGGCCTCACTTC
JAG1KBS B R CCTCAGGCACTACCTCCAGA
JAG1KBS C F CCTGAGGGTGTAAGTGATAGGC
JAG1KBS C R GAGGAAAGGGAAATGTTGGG
qRT-PCR mDll-1 F GCGACTGAGGTGTAAGATGGAA
mDll-1 R TCTCAGCAGCATTCATCGGG
mDll-4 F GCAAACTGCAGAACCACACA
mDll-4 R TGGCTTCTCACTGTGTAACCG
mNotch1 F ACAGTGCAACCCCCTGTATG
mNotch1 R TCTAGGCCATCCCACTCACA
mNotch2 F ACAGTGTTGGCTCCCTGTTC
mNotch2 R ATCGTTTACCTTGCCAGCCA
mHMBS F GATGGGCAACTGTACCTGACTG
mHMBS R CTGGGCTCCTCTTGGAATG
hDll1 F AGAAAGTGTGCAACCCTGGC
hDll-1 R CACTCTGCACTTGCATTCCCC
hJag1 F CGCAAGCGATGTAGATTGAATATT
hJag1 R CGCAAGCGATGTAGATTGAATATT
β-Actin F CTCTTCCAGCCTTCCTTCCT
β-Actin R AGCACTGTGTTGGCGTACAG