|
Protein short linear motifs
|
|
Cyclin docking motif [187]
|
19RRLF22
|
Cyclin fold of G1/S-specific cyclin-E1
|
Inhibition of Cyclin E-Cdk2 catalytic activity and substrate recruitment
|
|
Cyclin docking motif [188]
|
155RRLIF159
|
Cyclin fold of G1/S-specific cyclin-E1
|
Docking to the Cyclin E subunit of the Cyclin E-Cdk2 kinase complex, which results in phosphorylation of p21 at S130 by Cdk2 and subsequent destabilisation of p21
|
|
PCNA-binding PIP box [86, 186]
|
144QTSMTDFYHS153
|
Proliferating cell nuclear antigen
|
Inhibition of the DNA polymerase delta processivity factor PCNA, resulting in G1 and G2 cell cycle arrest
|
|
Nuclear localisation signal (NLS) [189]
|
142RRQTSMTDFYHSKRRLI158
|
Armadillo domain of Importin-alpha
|
Translocation of p21 from the cytosol to the nucleus where it exerts it’s effects on cell proliferation
|
|
APC/C-binding D Box degron [185]
|
86RDELGGGR93
|
WD40 repeat of Cell division cycle protein 20 homolog
|
Ubiquitylation of p21, thereby targeting the protein for proteasomal degradation during prometaphase
|
|
PIP degron motif [183]
|
145TSMTDFYHSKRRL157
|
WD40 repeat of Denticleless protein homolog
|
PCNA- and ubiquitin-dependent proteasomal degradation of p21 in S phase and after UV irradiation
|
|
Cdk2 phosphosite [193]
|
130(S)P131
|
Kinase domain of Cyclin-dependent kinase 2
|
Targets p21 for ubiquitylation and subsequent proteasomal degradation
|
|
PKB phosphosite [190]
|
140RKRRQ(T)145
|
Kinase domain of Protein kinase B (PKB)
|
Results in cytoplasmic localisation of p21, prevents complex formation with PCNA, and decreases the inhibitory effect on Cyclin-Cdk complexes
|
|
NDR phosphosite [192]
|
141KRRQT(S)146
|
Kinase domain of nuclear-Dbf2-related (NDR) kinases
|
Destabilisation of p21 protein to control G1/S progression
|
|
RNA motifs
|
|
miRNA [119]
|
miRNA seed region (AAAGUGC) complementary sites within the 3′-UTR
|
miRNA miR-17,20a, 20b, 93, 106a, and 106b
|
Down-regulation of p21 expression
|
|
HuD binding site [177, 220]
|
688UUGUCUU695
|
RRM domain of ELAV-like protein 4
|
Increased stability of p21 mRNA
|
|
HuR binding site [178, 220]
|
AU-rich elements within nt 751–850
|
RRM domain of ELAV-like protein 1
|
Increased stability of p21 mRNA
|
|
RNPC1 binding site [179, 220]
|
AU-rich elements within nt 621–750
|
RRM domain of RNA-binding protein 38
|
Increased stability of p21 mRNA
|
|
Msi-1-binding site [180]
|
1819GUAGU1823 (on a loop portion of a stem–loop–stem structure)
|
RRM domain of RNA-binding protein Musashi homolog 1
|
Inhibition of p21 mRNA translation to regulate progenitor maintenance
|
|
GC-rich sequence [148]
|
within nt 37–59
|
RRM domain of CUGBP Elav-like family member 1
|
Increased translation of p21 mRNA
|
|
GC-rich stem–loop structure [148]
|
within nt 37–59
|
Calreticulin
|
Blocks translation of p21 mRNA via stabilisation of a stem-loop structure within the 5′ region
|
|
CU-rich sequence [181]
|
CCANNCC within the 3′-UTR
|
KH domain of Heterogeneous nuclear ribonucleoprotein K
|
Repression of p21 mRNA translation
|
|
DNA regulatory elements
|
|
p53-responsive element [159, 160]
|
GAACATGTCCCAACATGTT at −2233 and GAAGAAGACTGGGCATGTCT at −1351
|
Cellular tumor antigen p53
|
p53-mediated up-regulation of p21 gene transcription in response to stress signals such as DNA damage
|
|
E-box motif [161]
|
CAGCTG at −420, −163, −20 and −5
|
Helix-Loop-Helix of Transcription factor AP-4
|
AP-4-dependent repression of p21 gene transcription in response to mitogenic signals
|
|
Retinoid X response element (RXRE) [162]
|
AGGTCAGGGGTGT at −1198 and GAGGCAAAGGTGA at −1221
|
zf-C4 zinc finger of Retinoic acid receptor RXR-alpha
|
RXR ligand-dependent induction of p21 gene expression by RXR-alpha
|
|
Retinoid acid response element (RARE) [163]
|
AGGTGAAGTCCAGGGGA at −1212
|
zf-C4 zinc finger of Retinoic acid receptor alpha (RAR-alpha)
|
Retinoic acid-dependent induction of p21 gene expression by RAR-alpha
|
|
Vitamin D response element (VDRE) [164]
|
AGGGAGATTGGTTCA at −770
|
zf-C4 zinc finger of Vitamin D3 receptor
|
1,25-dihydroxyvitamin D3-dependent induction of p21 gene expression by Vitamin D3 receptor
|
|
CDX binding site [167]
|
Three TTTAT within −471 to −434
|
Homeobox domain of Homeobox protein CDX-2
|
Activation of p21 gene transcription by CDX-2
|
|
T-element [168]
|
AGGTGTGA close to the transcription start site (TSS)
|
T-box of T-box transcription factor TBX2
|
Repression of the p21 gene promoter by TBX2
|
|
STAT binding element [165, 166]
|
TTCCCGGAA at −647, TTCTGAGAAA at −2541 and CTTCTTGGAAAT at −4183
|
STAT fold of Signal transducer and activator of transcription (STAT) proteins STAT1/STAT3/STAT5
|
STAT-dependent activation of p21 gene expression in response to several cytokines
|
|
NF-IL6 site [169]
|
GTACTTAAGAAATATTGAA at approximately −1900
|
bZIP domain of CCAAT/enhancer-binding protein beta
|
Induction of p21 gene expression by CCAAT/enhancer-binding protein beta
|
|
Sp1 binding site [170–173]
|
6 GC-rich Sp1-binding sites between −120 and TSS
|
C2H2 zinc finger of Transcription factor Sp1/Sp3
|
Sp1/Sp3-dependent induction of p21 gene expression
|
|
AP2 binding site [174]
|
GCGGTGGGC at −103
|
Transcription factor AP-2-alpha
|
Induction of p21 transcription and growth arrest by AP-2-alpha
|
|
E2F binding site [175]
|
CTCCGCGC at −155 and CGCGC at −103, −89 and −36
|
Winged-Helix of Transcription factor E2F1
|
Activation of the p21 gene at the G1/S boundary by E2F1
|
|
Forkhead binding site [176]
|
TGTGTGC at +200 3′ of TSS
|
Forkhead domain of Forkhead box protein P3
|
Induction of p21 transcription by Forkhead box protein P3
|
