Motif | Motif sequence | Binding domain/partner | Function |
---|---|---|---|
Protein short linear motifs | |||
 Cyclin docking motif [187] | 19RRLF22 | Cyclin fold of G1/S-specific cyclin-E1 | Inhibition of Cyclin E-Cdk2 catalytic activity and substrate recruitment |
 Cyclin docking motif [188] | 155RRLIF159 | Cyclin fold of G1/S-specific cyclin-E1 | Docking to the Cyclin E subunit of the Cyclin E-Cdk2 kinase complex, which results in phosphorylation of p21 at S130 by Cdk2 and subsequent destabilisation of p21 |
144QTSMTDFYHS153 | Proliferating cell nuclear antigen | Inhibition of the DNA polymerase delta processivity factor PCNA, resulting in G1 and G2 cell cycle arrest | |
 Nuclear localisation signal (NLS) [189] | 142RRQTSMTDFYHSKRRLI158 | Armadillo domain of Importin-alpha | Translocation of p21 from the cytosol to the nucleus where it exerts it’s effects on cell proliferation |
 APC/C-binding D Box degron [185] | 86RDELGGGR93 | WD40 repeat of Cell division cycle protein 20 homolog | Ubiquitylation of p21, thereby targeting the protein for proteasomal degradation during prometaphase |
 PIP degron motif [183] | 145TSMTDFYHSKRRL157 | WD40 repeat of Denticleless protein homolog | PCNA- and ubiquitin-dependent proteasomal degradation of p21 in S phase and after UV irradiation |
 Cdk2 phosphosite [193] | 130(S)P131 | Kinase domain of Cyclin-dependent kinase 2 | Targets p21 for ubiquitylation and subsequent proteasomal degradation |
 PKB phosphosite [190] | 140RKRRQ(T)145 | Kinase domain of Protein kinase B (PKB) | Results in cytoplasmic localisation of p21, prevents complex formation with PCNA, and decreases the inhibitory effect on Cyclin-Cdk complexes |
 NDR phosphosite [192] | 141KRRQT(S)146 | Kinase domain of nuclear-Dbf2-related (NDR) kinases | Destabilisation of p21 protein to control G1/S progression |
RNA motifs | |||
 miRNA [119] | miRNA seed region (AAAGUGC) complementary sites within the 3′-UTR | miRNA miR-17,20a, 20b, 93, 106a, and 106b | Down-regulation of p21 expression |
688UUGUCUU695 | RRM domain of ELAV-like protein 4 | Increased stability of p21 mRNA | |
AU-rich elements within nt 751–850 | RRM domain of ELAV-like protein 1 | Increased stability of p21 mRNA | |
AU-rich elements within nt 621–750 | RRM domain of RNA-binding protein 38 | Increased stability of p21 mRNA | |
 Msi-1-binding site [180] | 1819GUAGU1823 (on a loop portion of a stem–loop–stem structure) | RRM domain of RNA-binding protein Musashi homolog 1 | Inhibition of p21 mRNA translation to regulate progenitor maintenance |
 GC-rich sequence [148] | within nt 37–59 | RRM domain of CUGBP Elav-like family member 1 | Increased translation of p21 mRNA |
 GC-rich stem–loop structure [148] | within nt 37–59 | Calreticulin | Blocks translation of p21 mRNA via stabilisation of a stem-loop structure within the 5′ region |
 CU-rich sequence [181] | CCANNCC within the 3′-UTR | KH domain of Heterogeneous nuclear ribonucleoprotein K | Repression of p21 mRNA translation |
DNA regulatory elements | |||
GAACATGTCCCAACATGTT at −2233 and GAAGAAGACTGGGCATGTCT at −1351 | Cellular tumor antigen p53 | p53-mediated up-regulation of p21 gene transcription in response to stress signals such as DNA damage | |
 E-box motif [161] | CAGCTG at −420, −163, −20 and −5 | Helix-Loop-Helix of Transcription factor AP-4 | AP-4-dependent repression of p21 gene transcription in response to mitogenic signals |
 Retinoid X response element (RXRE) [162] | AGGTCAGGGGTGT at −1198 and GAGGCAAAGGTGA at −1221 | zf-C4 zinc finger of Retinoic acid receptor RXR-alpha | RXR ligand-dependent induction of p21 gene expression by RXR-alpha |
 Retinoid acid response element (RARE) [163] | AGGTGAAGTCCAGGGGA at −1212 | zf-C4 zinc finger of Retinoic acid receptor alpha (RAR-alpha) | Retinoic acid-dependent induction of p21 gene expression by RAR-alpha |
 Vitamin D response element (VDRE) [164] | AGGGAGATTGGTTCA at −770 | zf-C4 zinc finger of Vitamin D3 receptor | 1,25-dihydroxyvitamin D3-dependent induction of p21 gene expression by Vitamin D3 receptor |
 CDX binding site [167] | Three TTTAT within −471 to −434 | Homeobox domain of Homeobox protein CDX-2 | Activation of p21 gene transcription by CDX-2 |
 T-element [168] | AGGTGTGA close to the transcription start site (TSS) | T-box of T-box transcription factor TBX2 | Repression of the p21 gene promoter by TBX2 |
TTCCCGGAA at −647, TTCTGAGAAA at −2541 and CTTCTTGGAAAT at −4183 | STAT fold of Signal transducer and activator of transcription (STAT) proteins STAT1/STAT3/STAT5 | STAT-dependent activation of p21 gene expression in response to several cytokines | |
 NF-IL6 site [169] | GTACTTAAGAAATATTGAA at approximately −1900 | bZIP domain of CCAAT/enhancer-binding protein beta | Induction of p21 gene expression by CCAAT/enhancer-binding protein beta |
6 GC-rich Sp1-binding sites between −120 and TSS | C2H2 zinc finger of Transcription factor Sp1/Sp3 | Sp1/Sp3-dependent induction of p21 gene expression | |
 AP2 binding site [174] | GCGGTGGGC at −103 | Transcription factor AP-2-alpha | Induction of p21 transcription and growth arrest by AP-2-alpha |
 E2F binding site [175] | CTCCGCGC at −155 and CGCGC at −103, −89 and −36 | Winged-Helix of Transcription factor E2F1 | Activation of the p21 gene at the G1/S boundary by E2F1 |
 Forkhead binding site [176] | TGTGTGC at +200 3′ of TSS | Forkhead domain of Forkhead box protein P3 | Induction of p21 transcription by Forkhead box protein P3 |