Skip to main content

Advertisement

Table 2 Representative examples of motifs modulating the abundance and function of Cyclin-dependent kinase inhibitor 1 (p21)

From: Motif co-regulation and co-operativity are common mechanisms in transcriptional, post-transcriptional and post-translational regulation

Motif Motif sequence Binding domain/partner Function
Protein short linear motifs
 Cyclin docking motif [187] 19RRLF22 Cyclin fold of G1/S-specific cyclin-E1 Inhibition of Cyclin E-Cdk2 catalytic activity and substrate recruitment
 Cyclin docking motif [188] 155RRLIF159 Cyclin fold of G1/S-specific cyclin-E1 Docking to the Cyclin E subunit of the Cyclin E-Cdk2 kinase complex, which results in phosphorylation of p21 at S130 by Cdk2 and subsequent destabilisation of p21
 PCNA-binding PIP box [86, 186] 144QTSMTDFYHS153 Proliferating cell nuclear antigen Inhibition of the DNA polymerase delta processivity factor PCNA, resulting in G1 and G2 cell cycle arrest
 Nuclear localisation signal (NLS) [189] 142RRQTSMTDFYHSKRRLI158 Armadillo domain of Importin-alpha Translocation of p21 from the cytosol to the nucleus where it exerts it’s effects on cell proliferation
 APC/C-binding D Box degron [185] 86RDELGGGR93 WD40 repeat of Cell division cycle protein 20 homolog Ubiquitylation of p21, thereby targeting the protein for proteasomal degradation during prometaphase
 PIP degron motif [183] 145TSMTDFYHSKRRL157 WD40 repeat of Denticleless protein homolog PCNA- and ubiquitin-dependent proteasomal degradation of p21 in S phase and after UV irradiation
 Cdk2 phosphosite [193] 130(S)P131 Kinase domain of Cyclin-dependent kinase 2 Targets p21 for ubiquitylation and subsequent proteasomal degradation
 PKB phosphosite [190] 140RKRRQ(T)145 Kinase domain of Protein kinase B (PKB) Results in cytoplasmic localisation of p21, prevents complex formation with PCNA, and decreases the inhibitory effect on Cyclin-Cdk complexes
 NDR phosphosite [192] 141KRRQT(S)146 Kinase domain of nuclear-Dbf2-related (NDR) kinases Destabilisation of p21 protein to control G1/S progression
RNA motifs
 miRNA [119] miRNA seed region (AAAGUGC) complementary sites within the 3′-UTR miRNA miR-17,20a, 20b, 93, 106a, and 106b Down-regulation of p21 expression
 HuD binding site [177, 220] 688UUGUCUU695 RRM domain of ELAV-like protein 4 Increased stability of p21 mRNA
 HuR binding site [178, 220] AU-rich elements within nt 751–850 RRM domain of ELAV-like protein 1 Increased stability of p21 mRNA
 RNPC1 binding site [179, 220] AU-rich elements within nt 621–750 RRM domain of RNA-binding protein 38 Increased stability of p21 mRNA
 Msi-1-binding site [180] 1819GUAGU1823 (on a loop portion of a stem–loop–stem structure) RRM domain of RNA-binding protein Musashi homolog 1 Inhibition of p21 mRNA translation to regulate progenitor maintenance
 GC-rich sequence [148] within nt 37–59 RRM domain of CUGBP Elav-like family member 1 Increased translation of p21 mRNA
 GC-rich stem–loop structure [148] within nt 37–59 Calreticulin Blocks translation of p21 mRNA via stabilisation of a stem-loop structure within the 5′ region
 CU-rich sequence [181] CCANNCC within the 3′-UTR KH domain of Heterogeneous nuclear ribonucleoprotein K Repression of p21 mRNA translation
DNA regulatory elements
 p53-responsive element [159, 160] GAACATGTCCCAACATGTT at −2233 and GAAGAAGACTGGGCATGTCT at −1351 Cellular tumor antigen p53 p53-mediated up-regulation of p21 gene transcription in response to stress signals such as DNA damage
 E-box motif [161] CAGCTG at −420, −163, −20 and −5 Helix-Loop-Helix of Transcription factor AP-4 AP-4-dependent repression of p21 gene transcription in response to mitogenic signals
 Retinoid X response element (RXRE) [162] AGGTCAGGGGTGT at −1198 and GAGGCAAAGGTGA at −1221 zf-C4 zinc finger of Retinoic acid receptor RXR-alpha RXR ligand-dependent induction of p21 gene expression by RXR-alpha
 Retinoid acid response element (RARE) [163] AGGTGAAGTCCAGGGGA at −1212 zf-C4 zinc finger of Retinoic acid receptor alpha (RAR-alpha) Retinoic acid-dependent induction of p21 gene expression by RAR-alpha
 Vitamin D response element (VDRE) [164] AGGGAGATTGGTTCA at −770 zf-C4 zinc finger of Vitamin D3 receptor 1,25-dihydroxyvitamin D3-dependent induction of p21 gene expression by Vitamin D3 receptor
 CDX binding site [167] Three TTTAT within −471 to −434 Homeobox domain of Homeobox protein CDX-2 Activation of p21 gene transcription by CDX-2
 T-element [168] AGGTGTGA close to the transcription start site (TSS) T-box of T-box transcription factor TBX2 Repression of the p21 gene promoter by TBX2
 STAT binding element [165, 166] TTCCCGGAA at −647, TTCTGAGAAA at −2541 and CTTCTTGGAAAT at −4183 STAT fold of Signal transducer and activator of transcription (STAT) proteins STAT1/STAT3/STAT5 STAT-dependent activation of p21 gene expression in response to several cytokines
 NF-IL6 site [169] GTACTTAAGAAATATTGAA at approximately −1900 bZIP domain of CCAAT/enhancer-binding protein beta Induction of p21 gene expression by CCAAT/enhancer-binding protein beta
 Sp1 binding site [170173] 6 GC-rich Sp1-binding sites between −120 and TSS C2H2 zinc finger of Transcription factor Sp1/Sp3 Sp1/Sp3-dependent induction of p21 gene expression
 AP2 binding site [174] GCGGTGGGC at −103 Transcription factor AP-2-alpha Induction of p21 transcription and growth arrest by AP-2-alpha
 E2F binding site [175] CTCCGCGC at −155 and CGCGC at −103, −89 and −36 Winged-Helix of Transcription factor E2F1 Activation of the p21 gene at the G1/S boundary by E2F1
 Forkhead binding site [176] TGTGTGC at +200 3′ of TSS Forkhead domain of Forkhead box protein P3 Induction of p21 transcription by Forkhead box protein P3