Skip to main content

Table 2 Primers used for RT-PCR of markers for MSC-derived differentiation pathways

From: Differential expression of CCN-family members in primary human bone marrow-derived mesenchymal stem cells during osteogenic, chondrogenic and adipogenic differentiation

Alkaline phosphatase   
sense 5'TGGAGCTTCAGAAGCTCAACACCA 3' 368 – 391 NM_000478
antisense 5'ATCTCGTTGTCTGAGTACCAGTCC 3' 798 – 821 NM_000478
Osteocalcin   
sense 5'ATGAGAGCCCTCACACTCCTC 3' 19 – 39 NM_199173
antisense 5' GCCGTAGAAGCGCCGATAGGC 3' 292 – 312 NM_199173
Lipoprotein lipase   
sense 5'GAGATTTCTCTGTATGGCACC 3' 1261 – 1281 NM_000237
antisense 5'CTGCAAATGAGACACTTTCTC 3' 1516 – 1536 NM_000237
PPARγ2   
sense 5'GCTGTTATGGGTGAAACTCTG 3' 128 – 148 NM_015869
antisense 5'ATAAGGTGGAGATGCAGGCTC 3' 458 – 478 NM_015869
Collagen type II   
sense 5'GAACATCACCTACCACTGCAAG 3' 4318 – 4339 NM_001844
antisense 5'GCAGAGTCCTAGAGTGACTGAG 3' 4684 – 4705 NM_001844
Collagen type X   
sense 5'CCCTTTTTGCTGCTAGTATCC 3' 112 – 132 NM_000493
antisense 5'CTGTTGTCCAGGTTTTCCTGGCAC 3' 556 – 579 NM_000493
Collagen type XI   
sense 5'ACTTCTGACTGCCTCTGCTC 3' 5418 – 5437 NM_001854
antisense 5'GCTTTTGCCATGTGATTCTGCC 3' 5891 – 5912 NM_001854
Aggrecan   
sense 5'GCCTTGAGCAGTTCACCTTC 3' 1814 – 1833 NM_001135
antisense 5'CTCTTCTACGGGGACAGCAG 3' 2186 – 2205 NM_001135
Chondroadherin   
sense 5'ACCTGGACCACAACAAGGTC 3' 535 – 554 NM_001267
antisense 5'CACCTTCTCCAGGTTGGTGT 3' 907 – 923 NM_001267
Fibromodulin   
sense 5'CTTACCCCTATGGGGTGGAT 3' 175 – 194 NM_002023
antisense 5'AAGTAGCTATCGGGGACGGT 3' 792 – 811 NM_002023