Skip to main content

Table 1 Sequences of utilized primers

From: Melanoma stimulates the proteolytic activity of HaCaT keratinocytes

Gene Forward primer Reverse primer
TIMP1 gcttctggcatcctgttgttg acgctggtataaggtggtctg
TIMP2 ggtcagtgagaaggaagtggac gggggccgtgtagataaactc
TIMP3 gccttctgcaactccgacatc cagcttaaggccacagagactc
HPRT1 gaccagtcaacaggggacat gcttgcgaccttgaccatct