Skip to main content

Table 1 Primers in real-time PCR

From: STING protects against cardiac dysfunction and remodelling by blocking autophagy

Gene Species Forward primer Reverse primer
IL-1β Mouse AATGAAGGAACGGAGGAGCC CTCCAGCCAAGCTTCCTTGT
IL-6 Mouse GTTGCCTTCTTGGGACTGATG ATACTGGTCTGTTGTGGGTGGT
MCP-1 Mouse TGGCTCAGCCAGATGCAGT CCAGCCTACTCATTGGGATCA
HMGB1 Mouse CCGGCAAGTTTGCACAAAGA TTGGGAGGGCGGAGAATCAA
GAPDH Mouse ACTCCACTCACGGCAAATTC TCTCCATGGTGGTGAAGACA
ANP Mouse ACCTGCTAGACCACCTGGAG- CCTTGGCTGTTATCTTCGGTACCGG
Collagen1 Mouse AGGCT TCAGTGGTT TGGATG CACCAACAGCACCATCGTTA
Collagen3 Mouse CCCAACCCAGAGATCCCATT GAAGCACAGGAGCAGGTGTAGA
Fibronectin Mouse CGGTGGCTGTCAGTCAGA TCCCACTGCTGATTTATC
CTGF Mouse TGTGTGATGAGCCCAAGGAC AGTTGGCTCGCATCATAGTTG
STING Mouse ATCTATGCTAGTCGTAGTTTA CGTAGTGCTAGTGATTAGTC
ANP Rat ATGGGCTCCTTCTCCATCAC TCTTCGGTACCGGAAGCTG
BNP Rat TTCCTTAATCTGTCGCCGCTGG CAGCAGCTTCTGCATCGTGGAT
Collagen1 Rat GAGAGAGCATGACCGATGGATT TGGACATTAGGCGCAGGAA
Collagen3 Rat CAGACGGGAGTTTCTCCTCGGA GACCAGGAGGACCAGCAACTCC'
GAPDH Rat GACATGCCGCCTGGAGAAAC AGCCCAGGATGCCCTTTAGT