Skip to main content

Table 1 Sequence of primers used in qPCR

From: Inhibition of protein tyrosine phosphatase improves mitochondrial bioenergetics and dynamics, reduces oxidative stress, and enhances adipogenic differentiation potential in metabolically impaired progenitor stem cells

Gene Primer Sequence 5′–3′ Amplicon length (bp) Accession No
PPARγ F:
R:
TCCCTGTTTGTGTACAGCCTT
CTCCATGGCTGATTTCCCCT
191 XM_014846252.1
ADIPOQ F:
R:
GGAGATCCAGGTCTTGTTGG
TCGGGTCTCCAATCCTACAC
162 XM_014843352.1
Lep F:
R:
CACACGCAGTCAGTCTCCTC CGGAGGTTCTCCAGGTCAT 176 XM_014854289.1
SREBP-1c F:
R:
TCAGCGAGGCGGCTTTGGAGCAG
CATGTCTTCGATGTCGGTCAG
80 XM_008542859.1
SOD1 (Cu/Zn SOD) F:
R:
CATTCCATCATTGGCCGCAC
GAGCGATCCCAATCACACCA
130 NW_001867397.1
SOD2 (Mn SOD) F:
R:
GGACAAACCTGAGCCCCAAT
TTGGACACCAGCCGATACAG
125 NW_001867408.1
CAT F:
R:
ACCAAGGTTTGGCCTCACAA
TTGGGTCAAAGGCCAACTGT
112 XM_014851065.1
PPARGC1β F:
R:
CCTCAACTATCTTGCCGACACC
ATGGGTTCAGTCTCGGGGT
165 XM_023617445.1
OXA1L F:
R:
GACCTAGAAACCGTGGGACG
GGAAGATCACTTGGCTCCCC
105 XM_008528958.1
MRPL24 F:
R:
ATGATCCCTAGCGAAGCACC
TGTAGAGACTCGTACCCGCT
123 XM_001500466.4
MTERF4 F:
R:
CGCCACCTCCGTGCTATG
CCCAAATGAGGGGCATCAGG
147 XM_023644068.1
PUSL1 F:
R:
TCAGCCACTTCCAGGACCTA
AGCCACATCCAAGCTGTCTG
120 XM_023636046.1
TFAM F:
R:
ATGATGGCTTTGAGTCCAGG
CTAGATGATGGCGGGAGACTT
154 XM_023643450.1
NDUFA9 F:
R:
TTGGTATTCAGGCCACACCC
GCTGGCTTCACGTCTTCAAC
103 XM_001494601.4
UQCRC2 F:
R:
TGCTTCGTCTTGCATCCAGT
AACTCCGGTGACGTGGTAAC
193 XM_001494381.5
COX4I1 F:
R:
GAATAGGGGCACGAACGAGT
GCCACCCACTCCTCTTCAAA
138 XM_023637444.1
COX4I2 F:
R:
CCCCACCCCCAGATGTTCT
CGTGGTAGTTGGTGTAGGGG
136 XM_005604417.3
PIGBOS1 F:
R:
GTTGGGGTGGCTCAGATCAA
ACCCCTCCTTTACCGCTACT
126 XM_014733689.2
MIEF1 F:
R:
GTGAGCGCAAAGGCAAGAAA
CTTAACCGCCAGTGTAGCGA
128 XM_023631522.1
PINK1 F:
R:
GCACAATGAGCCAGGAGCTA GGGGTATTCACGCGAAGGTA 289 XM 014737247.1
PARKIN F:
R:
TCCCAGTGGAGGTCGATTCT CCCTCCAGGTGTGTTCGTTT 218 XM 014858374.1
MFN1 F:
R:
AAGTGGCATTTTTCGGCAGG TCCATATGAAGGGCATGGGC 217 XM 001495170.5
MFN2 F:
R:
AGGTGAAGTCAGAATTGGTGGA CTTCACAGGGGTGGCATCAT 129 XM_023635773.1
Fis F:
R:
GGTGCGAAGCAAGTACAACG GTTGCCCACAGCCAGATAGA 118 XM 001504462.4
MIRO1 F:
R:
GATCCTGCTGGTGGGAGAAC
GGGAGGAACCTCTTCTGGGA
88 XM_023651639.1
OPA1 F:
R:
CTTCTCTTGTTAGGTTCACCTGG
TGTAAGAGAATGAGCTCACCAAG
110 XM_003363363.4
DRP1 F:
R:
CAGCTAGTCCACGTTTCACC CCCTTTAGAAAGGTGTCTTGAGT 96 XM_023643346.1
LC3 F:
R:
TTCTGAGACACAGTCGGAGC
CTTTGTTCGAAGGTGTGGCG
128 XM_001493613.6
Beclin F:
R:
GATGCGTTATGCCCAGATGC
AACGGCAGCTCCTCTGAAAT
233 XM_014833759.1
Lamp2 F:
R:
GCACCCCTGGGAAGTTCTTA
ATCCAGCGAACACTCTTGGG
147 XM_014729146.2
GAPDH F:
R:
GATGCCCCAATGTTTGTGA
AAGCAGGGATGATGTTCTGG
250 NM_001163856.1
  1. Sequence: amplicon length and access numbers of the primer sets. PPARγ: Peroxisome proliferator-activated receptor gamma; ADIPOQ: Adiponectin; Lep: Leptin; CEBPA: CCAAT/enhancer-binding protein alpha; SREBP-1C: Sterol Regulatory Element Binding Protein-1c; AKT1: Serine-threonine protein kinase 1; AKT2: Serine-threonine protein kinase 2; INSR: Insulin receptor; IRS1: Insulin Receptor substrat 1; PI3K: Phosphoinositide 3-Kinase; SHBG: Sex hormone binding globulin; AHSG: Alpha 2-HS Glycoprotein; P53: tumor suppressor p53; Bcl-2: B-cell lymphoma 2; Bax: BCl-2 associated X protein; p21: Cyclin-dependent kinase inhibitor 1; Casp3: Caspase 3; Casp9: Caspase 9; Perk: PRKR-like endoplasmic reticulum kinase; Chop: C/EBP homologous protein; Atf6: Activating transcription factor 6; Ire1: Inositol-requiring enzyme; Xbp1: X-box binding protein 1Sod1 (Cu/Zn SOD): Copper-zinc-dependant superoxide dismutase (CuZnSOD; Sod2 (Mn SOD): Manganese-dependent superoxide dismutase (MnSOD); CAT: Catalase; PPARGC1β: Peroxisome proliferator-activated receptor γ coactivator 1-beta; OXA1L: OXA1L, mitochondrial inner membrane protein; MRPL24: Mitochondrial Ribosomal Protein L24; MTERF4: Mitochondrial Transcription Termination Factor 4; PUSL1: Pseudouridine Synthase Like 1; TFAM: Mitochondrial transcription factor A; NDUFA9: NADH ubiquinone oxidoreductase subunit A9; UQCRC2: Ubiquinol Cytochrome C Reductase Core Protein 2; COX4I1: Cytochrome c oxidase subunit 4 isoform 1; COX4I2: Cytochrome c oxidase subunit 4 isoform 2; PIGBOS1: PIGB, opposite strand protein 1; MIEF1: Mitochondrial Elongation Factor 1; PINK1: PTEN-induced kinase 1; PARKIN: Parkin RBR E3 ubiquitin protein ligase (PARK2); MFN1: Mitofusin 1; MFN2: Mitofusin 2; FIS1: mitochondrial fission 1 molecule; MIRO1: Ras Homolog Family Member T1; OPA1: OPA1, Mitochondrial Dynamin Like GTPase; DRP1: Dynamin-1-like protein; GADPH: glyceraldehyde-3-phosphate dehydrogenase