Skip to main content

Table 3 Primers used for RT-PCR

From: Lactate-induced MRP1 expression contributes to metabolism-based etoposide resistance in non-small cell lung cancer cells

Gene Genebank accession number Primer (5′-3′)
ABCA2 NM_212533 Forward: ATGTCAGCCTGCAAGAGGTG
Reverse: AGATCTGGGAGAAGAGTGCC
ABCC1 NM_004996 Forward: AGCCGGTGAAGGTTGTGTAC
Reverse: TGACGAAGCAGATGTGGAAG
ABCC3 NM_003786 Forward: CCTTTGCCAACTTTCTCTGC
Reverse: AGGGCACTCAGCTGTCTCAT
ABCC5 NM_005688 Forward: ACCCGTTGTTGCCATCTTAG
Reverse: GCTTTGACCCAGGCATACAT
ABCG2 NM_001348985 Forward: GCAGATGCCTTCTTCGTTATG
Reverse: CTGTCACAGTGGCCGTCACT