Skip to main content

Table 2 Sequences of siRNA

From: Lactate-induced MRP1 expression contributes to metabolism-based etoposide resistance in non-small cell lung cancer cells

Gene Genebank accession number Target sequence (5′-3′)
siLDHA NM_001165414.1 GCCAUCAGUAUCUUAAUGATT
siGPR81 NM_032554.3 CTGCTAGACTCTATTTCCT
siABCC1 NM_004996 GAUGACACCUCUCAACAAAdTdT
siTEAD1 NM_021961.6 GCCCUGUUUCUAAUUGUGGTT
siHIF-1α NM_001530 CCAGCAGACUCAAAUACAATT
siSnail NM _005985.3 CAAATACTGCAACAAGGAA
sic-Jun NM_002228 AAGAACGTGACAGATGAGCAG