Skip to main content

Table 1 Primers used for PCR amplifications

From: Lactate-induced MRP1 expression contributes to metabolism-based etoposide resistance in non-small cell lung cancer cells

Gene Genebank accession number Primer (5′-3′)
ABCC1 NM_004996 Fwd:AACAATCCTATCTACCTTCCTCCT
Rev.:CCACACACCCTGCGACCACTTTTCAA
ABCC1 NM_004996 Fwd:GGCTGCTCACGGGTTTGAATCT
Rev.:CCACACACCCTGCGACCACTTTTCAA
ABCC1 NM_004996 Fwd:AACAATCCTATCTAACGGACTCCT
Rev.:CCACACACCCTGCGACCACTTTTCAA
ABCC1 NM_004996 Fwd:TTAAGGCGCGTATGCGAAAGGCAGGTAGGGGGCT
Rev.:AGCCCCCTACCTGCCTTTCGCATACCGGGCGCCTTAA
ABCC1 NM_004996 Fwd:GGTACC CCTTCTGT GTGACTCAGC
Rev.:CCACACACCCTGCGACCACTTTTCAA
ABCC1 NM_004996 Fwd:GGTACC CCTTCTGT TGCGTATTGC
Rev.: CCACACACCCTGCGACCACTTTTCAA
ABCC1 NM_004996 Fwd:AACAATCCTATCTACCTTCCTCCT
Rev.:CCACACACCCTGCGACCACTTTTCAA