Skip to main content

Table 1 Primer sequences for qRT-PCR analysis

From: The PPAR-γ antagonist T007 inhibits RANKL-induced osteoclastogenesis and counteracts OVX-induced bone loss in mice

Primer 5′-3’
GAPDH-F ACCCAGAAGACTGTGGATGG
GAPDH-R CACATTGGGGGTAGGAACAC
CTSK-F CTTCCAATACGTGCAGCAGA
CTSK-R TCTTCAGGGCTTTCTCGTTC
c-Fos-F CCAGTCAAGAGCATCAGCAA
c-Fos-R AAGTAGTGCAGCCCGGAGTA
NFATc1-F CCGTTGCTTCCAAAAATAACA
NFATc1-R TGTGGGATGTGAACTCGGAA
Atp6v0d2-F GACCCTGTGGCACTTTTTGTATTC
Atp6v0d2-R GCTTGCATTTGGGGAATCTATC
DC-STAMP-F AAAACCCTTGGGCTGTTCTT
DC-STAMP-R AATCATGGACGACTCCTTGG
ALP-F CCAACTCTTTTGTGCCAGAGA
ALP-R GGCTACATTGGTGTTGAGCTTTT
OCN-F GAGGGCAATAAGGTAGTGAACAGA
OCN-R AAGCCATACTGGTTTGATAGCTCG
Runx2-F TTCTCCAACCCACGAATGCAC
Runx2-R CAGGTACGTGTGGTAGTGAGT
Acp5-F TCCGTGCTCGGCGATGGACCAGA
Acp5-R CTGGAGTGCACGATGCCAGCGACA
OSX-F GCTGCAAGCTCTCCATAACC
OSX-R GCCAGAAGCTGTGAAACCTC
COL1a-F TCAGACCACGGACGCCATCT
COL1a-R CGGCAACGATGGTGCTAAGG
OPG-F TGGAGAGGTAGAAAAGGCACA
OPG-R CAAACACACTCTTGGCACCAC
RANKL-F GCCAGTGGGAGATGTTAG
RANKL-R TTAGCTGCAAGTTTTCCC