Skip to main content

Advertisement

Table 1 Sequences of the primers

From: miR-449a regulates insulin signalling by targeting the Notch ligand, Jag1 in skeletal muscle cells

Gene nameForward Primer (5′-3′)Reverse Primer (5′-3′)
Jag1TGCCTCTGTGAGACCAACTGAGGGGTCAGAGAGACAAGCA
Hes1GTCTACACCAGCAACAGTGGCGTCAGAAGAGAGAGGTGGG
Hey1TCAGAGCAGTGAGGTGAAGGAGTGCAGGCAAGGTCTACAT
Jag1 3’UTRAATTAATTGTGTGAAGTTGGAAGCATGTTCCATGTTTTCATACAAAAAATT
Mutant 3’UTRACTTTGATTTCCTCACTTAAGGCAGGTCAGGTACTCTACGGCAAATCTAAACAGTGCACTGTTTAGATTTGCCGTAGAGTACCTGACCTGCCTTAAGTGAGGAAATCAAAGT