Skip to main content

Table 2 Primer sequences for quantitative RT PCR

From: Estrogen regulation of cardiac cAMP-L-type Ca2+ channel pathway modulates sex differences in basal contraction and responses to β2AR-mediated stress in left ventricular apical myocytes

Gene name   Primer sequence (5′ → 3′) Amplicon length [bp]
Forward Reverse  
Pde3a NC_000072.6 Reference GRCm38.p4 C57BL/6J TTTAACGCCAAGGTAAACGATG TGATGTCAGCCAGCTTTATACA 97
Pde3b NC_000073.6 Reference GRCm38.p4 C57BL/6J GAAAAAGTGCCTGTGATCAGAC TCTGTTCTCGGGAAATACAAGG 130
Pde4a NC_000075.6 Reference GRCm38.p4 C57BL/6J GCTGACCTGAAGACTATGGTAG GATACGGTCAGAGTAGTTGTCC 81
Pde4b NC_000070.6 Reference GRCm38.p4 C57BL/6J CAGGAAAATGGTGATTGACATGGTGTTGG CGAAGAACCTGTATCCGGTCAGTATAG  
Pde4d NC_000079.6 Reference GRCm38.p4 C57BL/6J CCAGAATCTGACCAAAAAGCAA GATCCTGTCGGAGTAGTTATCC 175
Atp2a2 NC_000071.6 Reference GRCm38.p4 C57BL/6J TTCTGCTTATCTTGGTAGCCAA CTTTCTGTCCTGTCGATACACT 125
Sln NC_000075.6 Reference GRCm38.p4 C57BL/6J ATGGAGAGGTCTACTCAGGAGCTG ACCTCACGAGGAGCCACATAAGG 82
Adrb2 NC_000084.6 Reference GRCm38.p4 C57BL/6J CACAAAGCCCTCAAGACTTTAG CCTGATAACGTGCACGATATTG 93
Ryr2 NC_000079.6 Reference GRCm38.p4 C57BL/6J CCATTGAGAACAAGTACATGCC AATTCGTTGTTCATCATGAGCC 112
Plb NC_000076.6 Reference GRCm38.p4 C57BL/6J TACCTCACTCGCTCGGCTATCAG CACAATGATGCAGATCAGCAGCAG 132
Cacna1c NC_000072.6 Reference GRCm38.p4 C57BL/6J GAGACAATGTGTGGAATATGCC GTAGGTAGAGTTGACCACGTAC 103