Skip to main content

Advertisement

Table 1 Primers designed for RT-PCR

From: Chemotherapy-driven increases in the CDKN1A/PTN/PTPRZ1 axis promote chemoresistance by activating the NF-κB pathway in breast cancer cells

Gene   Sequence
PTPRZ1 Sense TGGGAAAACAGTGGAAAT
Antisense CCGCATCAAAGCAGTAGA
β-actin Sense AGGGGCCGGACTCGTCATACT
Antisense GGCGGCACCACCATGTACCCT
IKKα Sense TTGTAGTTTAGTAGTAGAACCCAT
Antisense ATTCCAGTTTCACGCTCA
IKKβ Sense TGAATGAGGATGAGAAGACTG
Antisense GACCACGGACCTTGCTAC
IκBα Sense GCAGCAGACTCCACTCCAC
Antisense TCCACGATGCCCAGGTAG
p65 Sense GGCCATGGACGAACTGTT
Anti-sense GGTCTTGGTGGTATCTGTGCT
p50 Sense GTCTTACCCTCAGGTCAAAA
Antisense TGTCATTCGTGCTTCCAG