Skip to main content

Advertisement

Table 3 qPCR primers

From: Tonicity inversely modulates lipocalin-2 (Lcn2/24p3/NGAL) receptor (SLC22A17) and Lcn2 expression via Wnt/β-catenin signaling in renal inner medullary collecting duct cells: implications for cell fate and bacterial infection

Gene-name
(Accession number)
Forward primer
(5‘→3‘)
Reverse primer
(5‘→3‘)
Amplicon size (bp) Efficiency
(%)
Actb
(NM_007393.5)
CGTGCGTGACATCAAAGAGAA GGCCATCTC CTGCTCGAA 61 102
Ctnnb1 (β-catenin)
(NM_001165902.1)
TTAAACTCCTGCACCCACCAT AGGGCAAGGTTTCGAATCAA 73 103
B2m
(NM_009735.3)
AAATGCTGAAGAACGGGAAAA ATAGAAAGACCAGTCCTTGCTGAAG 77 96
Myc
(NM_001177352.1)
CGTTGGAAACCCCGCAGA TACGGAGTCGTAGTCGAGGT 86 97
Ccnd1
(NM_007631.2)
ACTGCCGAGAAGTTGTGCAT AAGCAGTTCCATTTGCAGCAG 72 101
Gapdh
(NM_008084.3)
CGGCCGCATCTTCTTGTG CCGACCTTCACCATTTTGTCTAC 59 100
Lcn2
(NM_008491.1)
CCACCACGGACTACAACCAG AGCTCCTTGGTTCTTCCATACA 100 98
Lcn2-R (Slc22a17)
(NM_021551.4)
CAGCCACCTCCTAACCGCTGTG CTCCCACTAGGATCAAAGGCTGCT 86 110
Wnt4
(NM_009523.2)
GAGAAGTGTGGCTGTGACCGG ATGTTGTCCGAGCATCCTGACC 77 92
Wnt5a
(NM_009524.3)
CTCCTTCGCCCAGGTTGTTATAG TGTCTTCGCACCTTCTCCAATG 196 117
  1. bp = base pairs