Skip to main content

Advertisement

Table 3 qPCR primers

From: Tonicity inversely modulates lipocalin-2 (Lcn2/24p3/NGAL) receptor (SLC22A17) and Lcn2 expression via Wnt/β-catenin signaling in renal inner medullary collecting duct cells: implications for cell fate and bacterial infection

Gene-name (Accession number) Forward primer (5‘→3‘) Reverse primer (5‘→3‘) Amplicon size (bp) Efficiency (%)
Actb (NM_007393.5) CGTGCGTGACATCAAAGAGAA GGCCATCTC CTGCTCGAA 61 102
Ctnnb1 (β-catenin) (NM_001165902.1) TTAAACTCCTGCACCCACCAT AGGGCAAGGTTTCGAATCAA 73 103
B2m (NM_009735.3) AAATGCTGAAGAACGGGAAAA ATAGAAAGACCAGTCCTTGCTGAAG 77 96
Myc (NM_001177352.1) CGTTGGAAACCCCGCAGA TACGGAGTCGTAGTCGAGGT 86 97
Ccnd1 (NM_007631.2) ACTGCCGAGAAGTTGTGCAT AAGCAGTTCCATTTGCAGCAG 72 101
Gapdh (NM_008084.3) CGGCCGCATCTTCTTGTG CCGACCTTCACCATTTTGTCTAC 59 100
Lcn2 (NM_008491.1) CCACCACGGACTACAACCAG AGCTCCTTGGTTCTTCCATACA 100 98
Lcn2-R (Slc22a17) (NM_021551.4) CAGCCACCTCCTAACCGCTGTG CTCCCACTAGGATCAAAGGCTGCT 86 110
Wnt4 (NM_009523.2) GAGAAGTGTGGCTGTGACCGG ATGTTGTCCGAGCATCCTGACC 77 92
Wnt5a (NM_009524.3) CTCCTTCGCCCAGGTTGTTATAG TGTCTTCGCACCTTCTCCAATG 196 117
  1. bp = base pairs