Skip to main content

Advertisement

Table 2 Primer sequences used for qRT-PCR

From: Transferrin receptor 1 is a supplementary receptor that assists transmissible gastroenteritis virus entry into porcine intestinal epithelium

Name Primer sequence (5′-3′)
TGEV-N F: caattcccgtggtcggaaga
R: tttacgttggcccttcacca
GAPDH F: tcatcatctctgccccttct
R: gtcatgagtccctccacgat