Skip to main content

Advertisement

Table 1 Primer sequences used for plasmids construction

From: Transferrin receptor 1 is a supplementary receptor that assists transmissible gastroenteritis virus entry into porcine intestinal epithelium

Name Primer sequence (5′-3′) Vector
shTfR1 shTfR1:ggacatgctcatctaggaaca pLVX-shRNA1
shCtrl: gcttgcacttaaagtagtaga
TfR1 F: ctcaagcttcgaattcatgatggatcaagctagat pLVX-DsRed
R: ggcgaccggtggatcccgttaaaattcattgtcaat
TfR1-Out F: tgatatcggatccgaattcgcctattgtaaacgtgtag pET-32a-c(+)
R: gcaagcttgtcgacaaattcattgtcaatgtc
F: cttaaggcctctgtcgacgcctattgtaaacgtgtag pAcGFP1-C
R: ccggtggatccgccagaattcttaaaattcattgtcaatgt
TGEV-S1 F: tctagcccgggcggatcctgtgctagttatgtggct pCMV-C-HA
R: atcgtatgggtatctagaatttgtataattatatatagag