Skip to main content

Table 1 Primers sequence

From: Inhibition of CRM1 activity sensitizes endometrial and ovarian cell lines to TRAIL-induced cell death

Targeted gene 5’- Forward primer − 3’ 5’- Reverse primer − 3’
DR4 cagagggatggtcaaggtcaagg ccacaacctcagccgatgc
DR5 cgctgcaccaggtgtgatt gtgccttcttcgcactgaca
DcR1 accaacgcttccaacaatgaa ctagggcacctgctacacttc
DcR2 gttggcttttcatgtcggaaga cccaggaactcgtgaaggac
PUMA acctcaacgcacagtacgag cccatgatgagattgtacagga
p21 ctggagactctcagggtcgaaa gattagggcttcctcttggagaa
p27 ggcctcagaagacgtcaaac acaggatgtccattccatga
18 s tggtcgctcgctcctctccc cagcgcccgtcggcatgtat
\