Skip to main content

Table 2 Gene names and primer sequences used in real-time PCR experiments

From: Glyceollins trigger anti-proliferative effects through estradiol-dependent and independent pathways in breast cancer cells

Gene name and symbol Forward primer Reverse primer
Progesterone receptor (PgR) CCCGCCGTCGTAACTTTGG GTGCCTATCCTGCCTCTCAATC
Growth regulation in breast cancer 1 (GREB1) GAGGATGTGGAGTGGAGACC CAGTACCTCAAAGACCTCGGC
Trefoil Factor 1(TFFI/pS2) ACCATGGAGAACAAGGTGA CCGAGCTCTGGGACTAATCA
Amphiregulin (AREG) GTATTTTCACTTTCCGTCTTGTTTTG CCTGGCTATATTGTCGATTCA
Forkhead box M1 (FOXM1) AGCGAGACCCATCAAAGTGG GGTCTTGGGGTGGGAGATTG
Estrogen receptor 1 (ESR1/ERα) TTTATGGGAAAAGGCTCAAA GACAAAACCGAGTCACATCA
Estrogen receptor 2 (ESR2/ERβ) AGAGTCCCTGGTGTGAAGCAAG GACAGCGCAGAAGTGAGCATC
FBJ murine osteosarcoma viral oncogene homolog (FOS) GAATTAACCTGGTGCTGGAT GAACACACTATTGCCAGGAA
Peroxisome proliferator-activated receptor gamma (PPARG) GCAATCAAAGTGGAGCCTGC CCCTTGCATCCTTCACAAGC
Hypoxia inducible factor 1, alpha subunit (HIF1A) CTGCCACCACTGATGAATTA GTATGTGGGTAGGAGATGGA
Endothelial PAS domain protein 1 (EPAS1/HIF2α) GCGCTAGACTCCGAGAACAT TGGCCACTTACTACCTGACCCTT
Vascular endothelial growth factor A (VEGFA) AGGAGGAGGGCAGAATCATCA CTCGATTGGATGGCAGTAGCT
DNA-damage-inducible transcript 4 (DDIT4/REDD1) AGGAAGCTCATTGAGTTGTG GGTACATGCTACACACACAT
Nuclear Receptor Subfamily 2 Group F member 1 (NR2F1/COUP-TFI) TACGTGAGGAGCCAGTACCC CGATGGGGGTTTTACCTACC
Chemokine (C-X-C motif) receptor 4 (CXCR4) GCCTTATCCTGCCTGGTATTGTC GCGAAGAAAGCCAGGATGAGGA
Atypical chemokine receptor 3 (ACKR3/CXCR7) ACAGGCTATGACACGCACTG ACGAGACTGACCACCCAGAC
Chemokine (C-X-C motif) ligand 12 (CXCL12) CTCCTGGGGATGTGTAATGG GCCTCCATGGCATACATAGG
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) GGGCATCCTGGGCTACACTG GGGCATCCTGGGCTACACTG
TATA box binding protein (TBP) TGCACAGGAGCCAAGAGTGAA CACATCACAGCTCCCCACCA