Skip to main content

Advertisement

Table 1 Gene primers list

From: Fibroblast growth factor 2 supports osteoblastic niche cells during hematopoietic homeostasis recovery after bone marrow suppression

Target gene Primer sequence  
  Forward (5′-3′) Reverse (5′-3′)
Gapdh GGCATTGCTCTCAATGACAA TGTGAGGGAGATGCTCAGTG
Alp GATAACGAGATGCCACCAGAGG TCCACGTCGGTTCTGTTCTTC
Runx2 AGATGATGACACTGCCACCTCTG GGGATGAAATGCTTGGGAACTGC
Opn TGCACCCAGATCCTATAGCC CTCCATCGTCATCATCATCG
Osx CTCTCTGCTTGAGGAAGAAG GTCCATTGGTGCTTGAGAAG
Ki67 CAGACGAGCAAGAGACAAAG AAGTACGGAGCCTGTATCAC
SDF-1 GCTCTGCATCAGTGACGGTA TAATTTCGGGTCAATGCACA
Jagged-1 CTTCAATCTCAAGGCCAGCC CAGGCGAAACTGAAAGGCAG
N-cadherin ACGAGAGGCCTATCCATGCTGAGC TCAGTCGTCACCACCGCCGTACAT
Vcam-1 ATTTTCTGGGGCAGGAAGTT ACGTCAGAACAACCGAATCC
Angpt1 AGGCTTGGTTTCTCGTCAGA TCTGCACAGTCTCGAAATGG
Fgfr1IIIb CTTGACGTCGTGGAACGATCT AGA ACGGTCAACCATGCAGAG
Fgfr1IIIc AGAGACCAGCTGTGATGACC TGTTACCTGTCTGCGCAGAG
Fgfr2IIIb CCCATCCTCCAAGCTGGACTG CAGAGCCAGCACTTCTGCATTG
Fgfr2IIIc CCCATCCTCCAAGCTGGACTG TCTCACAGGCGCTGGCAGAAC
Fgfr3IIIb GGCGCTAACACCACCGAC TGGCAGCACCACCAGCCAC
Fgfr3IIIc TGGAAACTGATGAGGCTGGC AAACGAGAGACCTTGTGCAC