Skip to main content

Table 1 The sequences of gene primers used for RT-PCR

From: Long-term culture and significant expansion of human Sertoli cells whilst maintaining stable global phenotype and AKT and SMAD1/5 activation

Gene Primer sequence Product size (bp) Tm(°C)
WT1 Forward TGACTCTCCACTCCTCCTCAC 170 60
Reverse ACCAACTCTTCCAGGCACAC
GATA4 Forward GCCTCCTCTGCCTGGTAAT 210 60
Reverse CAGTCCCATCAGCGTGTAAA
GATA1 Forward GAAACCGCAAGGCATCTG 140 60
Reverse CCCAGCCACCACCATAAAG
GDNF Forward TGAAACCAAGGAGGAACT 180 58
Reverse CACTCACCAGCCTTCTATT
BMP4 Forward TTTGTTCAAGATTGGCTGTC 324 60
Reverse AGATCCCGCATGTAGTCC
SCF Forward GTCATTGTTGGATAAGCGAGAT 457 60
Reverse ATGGCTGCCCAGTGTAGG
FGF2 Forward TCCTTTCTCCCTCGTTTCTTC 195 55
Reverse GATGTTTCCCTCCAATGTTTC
EGF Forward CTGATATAGATGAATGTGAGATGGG 190 55
Reverse GTGGAGTAGAGTCAAGACAG
FSHR Forward TCTGCTGGTTCTGTTTCA 215 58
Reverse CATTCCTTGGATGGGTGT
AR Forward CCTTCACCAATGTCAACTCC 197 60
Reverse CCACTGGAATAATGCTGAAGAG
ABP Forward GGCTTTACCAGGAGAAGAC 150 60
Reverse CATGGCTTCTGTTCAGGG
ACTB Forward CGCACCACTGGCATTGTCAT 253 55
Reverse TTCTCCTTGATGTCACGCAC