Skip to main content

Table 1 Primers used for RT-PCR

From: Differential expression of CCN-family members in primary human bone marrow-derived mesenchymal stem cells during osteogenic, chondrogenic and adipogenic differentiation

gene product   primer sequence # in database entry
CYR61/CCN1 sense 5'ACCAGTCAGGTTTACTTACG 3' 962 – 981 NM_001554
  antisense 5'TGCCTCTCACAGACACTCAT 3' 1679 – 1698 NM_001554
CTGF/CCN2 sense 5'AACACCATAGGTAGAATGTAAAGC 3' 1921 – 1944 NM_001901
  antisense 5'CTGATCAGCTATATAGAGTCACTC 3' 2130 – 2153 NM_001901
WISP2/CCN5 sense 5'CACGCATAGGCTTGTATTCAGGAAC 3' 1052 – 1075 NM_003881
  antisense 5'CACGCTGCCTGGTCTGTCTGGATC 3' 1379 – 1403 NM_003881
WIS32/CCN6 sense 5'CTGTGTTACATTCAGCCTTGCGAC 3' 846 – 869 NM_003880
  antisense 5'CTTGGTTTTACAGAATCTTGAGCTC 3' 1158 – 1182 NM_003880
actin sense 5'CGGGAAATCGTGCGTGACAT 3' 689 – 708 NM_001101
  antisense 5'GAACTTTGGGGGATGCTCGC 3' 1381 – 1400 NM_001101