Skip to main content

Table 1 Primers used for quantitative real-time PCR

From: Spheroid formation of human thyroid cancer cells under simulated microgravity: a possible role of CTGF and CAV1

Gene Primer name Sequence
18S rRNA 18S-F GGAGCCTGCGGCTTAATTT
  18S-R CAACTAAGAACGGCCATGCA
CAV1 CAV1-F GTACGACGCGCACACCAA
  CAV1-R TCCCTTCTGGTTCTGCAATCA
CAV2 CAV2-F GATCCCCACCGGCTCAAC
  CAV2-R CACCGGCTCTGCGATCA
CD44 CD44-F ACCCTCCCCTCATTCACCAT
  CD44-R GTTGTACTACTAGGAGTTGCCTGGATT
CTGF CTGF-F ACAAGGGCCTCTTCTGTGACTT
  CTGF-R GGTACACCGTACCACCGAAGAT
EGF EGF-F TGCCAGCTGCACAAATACAGA
  EGF-R TCTTACGGAATAGTGGTGGTCATC
ERK1 ERK1-F ACCTGCGACCTTAAGATTTGTGA
  ERK1-R AGCCACATACTCCGTCAGGAA
IL8 IL8-F TGGCAGCCTTCCTGATTTCT
  IL8-R GGGTGGAAAGGTTTGGAGTATG
ITGB1 ITGB1-F GAAAACAGCGCATATCTGGAAATT
  ITGB1-R CAGCCAATCAGTGATCCACAA
NFKBP65 NFKBP65-F CGCTTCTTCACACACTGGATTC
  NFKBP65-R ACTGCCGGGATGGCTTCT
OPN OPN-F CGAGGTGATAGTGTGGTTTAT GGA
  OPN-R CGTCTGTAGCATCAGGGTACTG
PRKCA PKCC-F CATTCAACAGCTGGGCAAGTT
  PKCC-R GTAGATGATGCCCTGATTGTGAAG
TLN1 TLN1-F GATGGCTATTACTCAGTACAGACAACTGA
  TLN1-F CATAGTAGACTCCTCATCTCCTTCCA
VEGFA VEGFA-F GCGCTGATAGACATCCATGAAC
  VEGFA-R CTACCTCCACCATGCCAAGTG
VEGFD VEGFD-F TGCAGGAGGAAAATCCACTTG
  VEGFD-R CTCGCAACGATCTTCGTCAA
NGAL NGAL-F AGGGAGTACTTCAAGATCACCCTCTA
  NGAL-R AGAGATTTGGAGAAGCGGATGA
MSN MSN-F GAAATTTGTCATCAAGCCCATTG
  MSN-R CCATGCAAGGCCAAGAT
  1. All sequences are given in 5’-3’ direction.