Skip to main content

Table 1 Forward and reverse primer sequences for real-time-PCR

From: Prostaglandin E2 alters Wnt-dependent migration and proliferation in neuroectodermal stem cells: implications for autism spectrum disorders

Gene Primer sequences (5′→ 3′) Amplicon size (base pair)
Hprt F: TCCATTCCTATGACTGTAGATTTTATCAG 75
R: AACTTTTATGTCCCCCGTTGACT
Pgkl F: CAGTTGCTGCTGAACTCAAATCTC 65
R: GCCCACACAATCCTTCAAGAA
Ptgs2 F: CAGCCAGGCAGCAAATCC 81
R: TTATACTGGTCAAATCCTGTGCTCAT
Ctnnbl F: GGACGTTCACAACCGGATTG 71
R: GAGAATAAAGCAACTG CACAAACAA
Ccndl F: GCACTTTCTTTCCAGAGTCATCAA 79
R: CTCCAGAAGGGCTTCAATCTGT
Mmp9 F: TCGCGTGGATAAGGAGTTCTCT 73
R: ATAGGCTTTGTCTTGGTACTGGAAGA