Skip to main content

Advertisement

Table 2 Overview of primers used for qRT-PCR analysis

From: Cell plasticity in wound healing: paracrine factors of M1/ M2 polarized macrophages influence the phenotypical state of dermal fibroblasts

Target gene Forward sequence Reverse sequence
ACTA2 CTGTTCCAGCCATCCTTCAT TCATGATGCTGTTGTAGGTGGT
CCL18 ATGGCCCTCTGCTCCTGT AATCTGCCAGGAGGTATAGACG
CCL2 AGTCTCTGCCGCCCTTCT GTGACTGGGGCATTGATTG
CCL7 ATGAAAGCCTCTGCAGCACT TCTGTAGCAGCAGGTAGTTGAAGT
CD14 AGCTAAAGCACTTCCAGAGC AGTTGTGGCTGAGGTCTAGG
CD40 GGTCTCACCTCGCTATGGTT CAGTGGGTGGTTCTGGATG
CD68 GTCCACCTCGACCTGCTCT CACTGGGGCAGGAGAAACT
CLEC10A AGGGTTTCAAGCAGGAACG AGGTGTGCCTTCTGCGTAGT
COL1A1 GCCTCAAGGTATTGCTGGAC ACCTTGTTTGCCAGGTTCAC
COL3A1 CTGGACCCCAGGGTCTTC CATCTGATCCAGGGTTTCCA
GAPDH AGCCACATCGCTCAGACAC GCCCAATACGACCAAATCC
IL1B TACCTGTCCTGCGTGTTGAA TCTTTGGGTAATTTTTGGGATCT
IL1R2 TTTCTGCCTTCACCCTTCAG GGCACCTCAGGGCTACAG
IL6 ACTTGCCTGGTGAAAATCAT CAGGAACTGGATCAGGACTT
MMP1 GCTAACCTTTGATGCTATAACTACGA TTTGTGCGCATGTAGAATCTG
MMP14 TACTTCCCAGGCCCCAAC GCCACCAGGAAGATGTCATT
MMP2 CCCCAAAACGGACAAAGAG CTTCAGCACAAACAGGTTGC
MMP3 CAAAACATATTTCTTTGTAGAGGACAA TTCAGCTATTTGCTTGGGAAA
MRC1 ACACCAAAACCTGAGCCAAC CCACCCATCTTCAGTAACTGGT
TAGLN CTGTTCCAGCCATCCTTCAT TCATGATGCTGTTGTAGGTGGT
TIMP1 GAAGAGCCTGAACCACAGGT CGGGGAGGAGATGTAGCAC
YWHAZ GATCCCCAATGCTTCACAAG TGCTTGTTGTGACTGATCGAC